DigitalGens

A free, fully client-side web server for genotyping assay design across SNP, InDel, copy-number, microsatellite and haplotype variants — allele-specific PCR, fluorescent probes, single-base extension, ligation-dependent amplification and fragment analysis, in one place.

No login · no registration Sequences never leave your browser GPL-3.0
This website is free and open to all users and there is no login requirement. DigitalGens is released under the GNU General Public License v3.0 — you are free to use, study, modify and redistribute it. Source code: github.com/rkalendar/PCRtools. Full terms: Licence.
Quick start
1
Mark the variant in your sequence

Paste one or more sequences in FASTA format and put the alleles in square brackets at the variant position. Everything else is optional.

>SNP_example
tgaactacggcgtgcgactaccgcggataaacctgtgtaaagaatataagtgttactcg
[C/T] tcaattccgcgatctagttaatccgcttcgttagtcgtattcatgggacagaaattatg
>InDel_example
tgtccatatgtcgaacggtcagagaccgctgacactagtgca
[/ATAGACGTCGATCGT] gttgctccacatggcagaaagaaatgaggatgagtggaaaatcc

[C/T] a biallelic SNP · [/ATAG…] an insertion · [ATAG…/] a deletion · [ACGT…/TGCA…] a haplotype or MNV. Full syntax, IUPAC and modified-base codes: targeting markup and input formats.

2
Run it on our example data

Each button opens a module with a worked example already loaded, so you can press Generate and see real output immediately.

3
Read and export the design

Results appear on screen as ranked oligonucleotide tables. How to read the output · Export formats · Troubleshooting.

Which assay do I need?
A few SNPs, many samples, tight budget

Allele-specific PCR read on a plate reader — or on a gel, by product length, with no reader at all.

KASP / AS-PCR →
Real-time allelic discrimination, multiplex

Dual-labelled hydrolysis or hairpin probes.

TaqMan / MGB / beacon →
Rare somatic mutation in cfDNA or FFPE

Competitive allele-specific TaqMan, down to 0.1%.

castPCR →
Many SNPs on capillary electrophoresis

Single-base extension, no real-time instrument needed.

SNaPshot →
Copy number, deletions and duplications

Ligation-dependent half-probes; up to 1000 targets by NGS.

MLPA / digitalMLPA → · QF-PCR →
Length polymorphism, forensics, parentage

Microsatellite fragment sizing with universal fluorescent tails.

STR / SSR →
Genotyping assay-design modules
KASP / allele-specific PCR

Allele-specific primers for KASP, PACE, ASQ and generic AS-PCR. Biallelic SNPs, InDels and complex haplotypes, with automatic tail selection and Tm balancing. An allele-sizing mode trades the fluorophore for a gel: 5′-tails space the allele products into a ladder, so the genotype is read off band length.

AS-PCR KASP PACE Haplotypes Gel readout
Open tool → Run example Docs
Dual-labelled qPCR probes

TaqMan, MGB and molecular-beacon probes for quantitative allelic discrimination — allele-specific pairs with matched Tms and minimal cross-reactivity, with a multiplex mode.

TaqMan MGB Molecular beacon Multiplex
Open tool → Run example Docs
castPCR — competitive allele-specific TaqMan

Rare somatic mutations down to 0.1% allele frequency. Designs the competitive triplet — allele-specific primer, allele-specific probe and common counter-primer — in both orientations, with multiplexing.

cfDNA / ctDNA FFPE Liquid biopsy Oncology
Open tool → Run example Docs
SNaPshot single-base extension

Single-base-extension primers for multiplex SNP and InDel genotyping on capillary electrophoresis. Also supports BAC fingerprinting and CpG-methylation minisequencing.

SBE Minisequencing Capillary CE Methylation
Open tool → Run example Docs
MLPA / digitalMLPA

Ligation-dependent half-probe pairs (LPO + RPO) with stuffer sequences and universal tags, for copy-number, SNP and InDel detection by capillary electrophoresis or, for up to 1000 targets, by sequencing.

Copy number / CNV Ligation Dosage Deletion / Duplication
Open tool → Run example Docs
STR / SSR fragment analysis

Flanking primers for microsatellite genotyping by capillary-electrophoresis fragment sizing, with economical universal-tail fluorescent labelling and automatic multiplex dye/size assignment.

Microsatellite M13 tail Multiplex Forensics / parentage
Open tool → Run example Docs
PCR, Multiplex & QF-PCR

General-purpose design engine covering standard, inverse, multiplex, TaqMan/MGB-probe, bisulphite and RPA assays. The quantitative-fluorescent mode generates STR-flanking primers for dosage and copy-number analysis.

Multiplex PCR QF-PCR Bisulphite RPA
Open tool → Run example Docs
Universal PCR from an alignment

Consensus primers designed from a multiple sequence alignment of two or more sequences: every 3′-end fully conserved across all inputs, with optional IUPAC-degenerate 5′-ends for pan-specific amplification of divergent targets.

MSA consensus Conserved 3′-end Degenerate primers
Open tool → Run example Docs
CRISPR guide RNA design

Cas9 and Cas12a guides with activity and specificity scoring, an off-target search across the sequences you supply, HDR/ssODN donors carrying a silent PAM-blocking change, the primers that screen the edit, prime-editing pegRNAs with a Tm-matched PBS, and base-editing windows with bystander prediction.

gRNA Off-targets HDR donor Prime editing Base editing
Open tool → Load example Docs
CRISPR diagnostics (SHERLOCK / DETECTR)

Collateral-cleavage detection assays: Cas12a and Cas13a crRNAs with allele-specific synthetic-mismatch discrimination, RPA pre-amplification primers with a T7 promoter where the enzyme needs a transcript, and the quenched ssDNA/ssRNA reporter for fluorescence or lateral flow.

crRNA RPA Isothermal Lateral flow
Open tool → Load example Docs
TSDR toehold exchange probes

Toehold-mediated strand-displacement exchange probes for high-specificity SNP/allele discrimination. Tunes the probe to a near-thermoneutral reaction and scores single-base mismatches with measured nearest-neighbour thermodynamics.

Toehold exchange Strand displacement SNP discrimination Isothermal
Open tool → Load example Docs
In Silico PCR (ePCR)

Virtual PCR against sequences you supply: where each primer, probe, miRNA or gRNA binds, which pairs give an amplicon and at what size, and which bindings are off-target. Mismatches are allowed, so a primer that anneals imperfectly is still found.

Virtual PCR Off-targets Mismatches Probes / miRNA
Open tool → Run example Docs
Method comparison
fully supported   ± partially supported   not applicable
Capability KASP / AS-PCR qPCR probes castPCR SNaPshot SBE TSDR probes MLPA QF-PCR STR / SSR
SNP genotyping
InDel detection
STR / microsatellite ±
Multiplex (≥ 10 loci) ± ±
Haplotype phasing ±
Methylation analysis
qPCR instrument required ±
Capillary electrophoresis
Low-cost plate reader
Rare-allele detection (≥ 0.1%) ±
Dosage / CNV analysis ± ± ±
Citing DigitalGens

If DigitalGens contributed to your work, please cite the accompanying paper. A full list of related publications is on the References & Citation page.

Citation details will be added on publication.

Licence, source and support